Insertion junction: LMJ.RY0402.050285_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.050285
Chromosome:chromosome_2
Location:3212811
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g095072 FAP144 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTCAAAGTCAGAAGCCAAAATCCAAAATCA
Internal bar code:TTCGCGGCTACACGCTTAACTA

Confirmation - LEAP-Seq

LEAP-Seq distance:897
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:2
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGTTTGACCACAAGCAC
Suggested primer 2:CTACCTGCCAGCTTCTGTCC