| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.050366 |
| Chromosome: | chromosome 12 |
| Location: | 1617001 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g486350 | STPK3,STK3 | (1 of 3) K07359 - calcium/calmodulin-dependent protein kinase kinase (CAMKK); Serine/threonine protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCGCTACACGGGTACAGGTGGGCTCAG |
| Internal bar code: | TCACATTCATCGCAGTTCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 756 |
| LEAP-Seq percent confirming: | 98.901 |
| LEAP-Seq n confirming: | 14938 |
| LEAP-Seq n nonconfirming: | 166 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCACACACACACACACAC |
| Suggested primer 2: | ATACGGATAAGGGACTGGGG |