| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.050403 |
| Chromosome: | chromosome 8 |
| Location: | 4989421 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g385900 | BOLA3 | (1 of 1) PTHR12735//PTHR12735:SF19 - BOLA-LIKE PROTEIN-RELATED // BOLA-LIKE PROTEIN 3; BolA-like protein 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCTGGCGGACGACCTCAAGCAGTGGCA |
| Internal bar code: | GGGACTTCGCAGGCGAATAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 805 |
| LEAP-Seq percent confirming: | 98.8166 |
| LEAP-Seq n confirming: | 167 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCTAAAACATTGCGGGGA |
| Suggested primer 2: | AAGTGGACTGTATCCGCACC |