Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.050412 |
Chromosome: | chromosome 11 |
Location: | 1668540 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467775 | (1 of 88) IPR011333 - POZ domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGCACCAACCCAACACGCCGCCAGCTC |
Internal bar code: | CGGTGGGGATTTAAGCTCGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 834 |
LEAP-Seq percent confirming: | 93.1168 |
LEAP-Seq n confirming: | 27746 |
LEAP-Seq n nonconfirming: | 2051 |
LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGTGATTAGGCGATGAT |
Suggested primer 2: | GCAGAGCCTCCTGTTGTTTC |