| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.050509 |
| Chromosome: | chromosome 11 |
| Location: | 2929440 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478050 | (1 of 12) IPR000104//IPR002893 - Antifreeze protein, type I // Zinc finger, MYND-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGACTCGTGCTGTCGCATGGAGATCGA |
| Internal bar code: | CCTGCGCGGACGGGCCTTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 537 |
| LEAP-Seq percent confirming: | 99.7664 |
| LEAP-Seq n confirming: | 8116 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGGTACCATATCAGCGA |
| Suggested primer 2: | TTGCAGCTGATTATTGCGAC |