| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.050799 |
| Chromosome: | chromosome 7 |
| Location: | 2447461 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329050 | NCD7,AOC5 | Cationic amino acid transporter; (1 of 2) K03294 - basic amino acid/polyamine antiporter, APA family (TC.APA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCATGGTTCACTCAGCCAATAACGTGG |
| Internal bar code: | CGGCATATGTACAGTGGAGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 99.4597 |
| LEAP-Seq n confirming: | 4234 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCCTCCCTGCATTCACTC |
| Suggested primer 2: | AGTAACATGGCTTCGCGTCT |