| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.050863 |
| Chromosome: | chromosome 5 |
| Location: | 1010345 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g246551 | (1 of 1) IPR000104//IPR001810//IPR020683 - Antifreeze protein, type I // F-box domain // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAACCACCACCCCGGTGCATCCTGTACCG |
| Internal bar code: | TCCAACTATGGCCGCGACGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 166 |
| LEAP-Seq percent confirming: | 94.8417 |
| LEAP-Seq n confirming: | 809 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | TGTCTCATGCCAGCTAATGC |