| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.050948 |
| Chromosome: | chromosome 3 |
| Location: | 6017565 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g190950 | TUA1 | (1 of 2) K07374 - tubulin alpha (TUBA); Alpha tubulin 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTACCCCTCGCGAACCCAGCGTAGGAAAA |
| Internal bar code: | CGTATGCGACGGGCCATGTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 974 |
| LEAP-Seq percent confirming: | 99.1546 |
| LEAP-Seq n confirming: | 4809 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTGAGAATTGTCTGGCA |
| Suggested primer 2: | AAGGGTACGAAAACTGGGCT |