| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.051040 |
| Chromosome: | chromosome 7 |
| Location: | 3723227 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337800 | MRPS17,uS17m | (1 of 3) PTHR10744 - 40S RIBOSOMAL PROTEIN S11 FAMILY MEMBER; Mitochondrial ribosomal protein S17 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCCATCCTACCTAGCAACCTGCCTAA |
| Internal bar code: | GCTGCCTACGTGTGGTACCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 404 |
| LEAP-Seq percent confirming: | 18.6477 |
| LEAP-Seq n confirming: | 433 |
| LEAP-Seq n nonconfirming: | 1889 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTAGACGTCGGAGCAGT |
| Suggested primer 2: | CGTGACCCTTTATCCCTTGA |