| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.051083 |
| Chromosome: | chromosome 9 |
| Location: | 5011142 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398067 | FKB62,ROF1 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516:SF324 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP62 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCCCCTCCGACACCGTGAAGGTCACGG |
| Internal bar code: | GTTACCCAGTAGCGGAAACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 101 |
| LEAP-Seq percent confirming: | 98.1651 |
| LEAP-Seq n confirming: | 107 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGTGATCAACCCCCAAC |
| Suggested primer 2: | CCACCGTGTTCTCATTGTTG |