Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.051088 |
Chromosome: | chromosome 6 |
Location: | 5214036 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g282000 | SSIII,STA3,SSS3A,SSS3 | (1 of 1) PF00534//PF08323//PF16760 - Glycosyl transferases group 1 (Glycos_transf_1) // Starch synthase catalytic domain (Glyco_transf_5) // Starch/carbohydrate-binding module (family 53) (CBM53); Soluble starch synthase III | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGTTAGGAGGGGCGGCGAGGGCGCGGGG |
Internal bar code: | GGTTGATCGGGTTCTTGTAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 177 |
LEAP-Seq percent confirming: | 99.8454 |
LEAP-Seq n confirming: | 646 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTAGATACACGCACGCACG |
Suggested primer 2: | CGTGCAGTCGCTTTGTGTAT |