| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.051133 |
| Chromosome: | chromosome 4 |
| Location: | 3861512 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g230242 | MOT40 | (1 of 1) IPR007914//IPR015422 - Uncharacterised protein family UPF0193 // Pyridoxal phosphate-dependent transferase, major region, subdomain 2; Predicted protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTTCTCCTGCCCGACGTCCCGTCCCTC |
| Internal bar code: | TGGTGTGCTTTGCACGTGATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 97 |
| LEAP-Seq percent confirming: | 62.332 |
| LEAP-Seq n confirming: | 1438 |
| LEAP-Seq n nonconfirming: | 869 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTCAAAACCCTCAGAC |
| Suggested primer 2: | CCAGACCTATTCGGTGCAAT |