| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.051181 |
| Chromosome: | chromosome 11 |
| Location: | 2501898 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475750 | (1 of 1) PF04187 - Haem-binding uptake, Tiki superfamily, ChaN (Cofac_haem_bdg) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGGCGGGACGCAGCGGCAGCGGTGGC |
| Internal bar code: | GGAGGTTTATCGCAAGACGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 187 |
| LEAP-Seq percent confirming: | 98.4043 |
| LEAP-Seq n confirming: | 185 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATACCAACACCAACACCA |
| Suggested primer 2: | CTTACAAGATGGGGCGTGAT |