| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.051215 |
| Chromosome: | chromosome 9 |
| Location: | 7126768 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g411950 | (1 of 3) IPR001005//IPR009057//IPR017877//IPR017930 - SANT/Myb domain // Homeodomain-like // Myb-like domain // Myb domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAATGCCGCCGCCGCCGATGCCCATTTT |
| Internal bar code: | AGGTGGGAGCACACGTAGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 11 |
| LEAP-Seq percent confirming: | 15.0239 |
| LEAP-Seq n confirming: | 346 |
| LEAP-Seq n nonconfirming: | 1957 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAACAAAGAGCACCCACC |
| Suggested primer 2: | AACACCAACAGCACCAACAA |