| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.051245 |
| Chromosome: | chromosome 2 |
| Location: | 429940 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076200 | (1 of 1) 3.4.11.2 - Membrane alanyl aminopeptidase / Peptidase E | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGTTGAACACAAAGTCCCAGGTGCGCT |
| Internal bar code: | TTTCCCTATTTTCCATGGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 202 |
| LEAP-Seq percent confirming: | 44.4444 |
| LEAP-Seq n confirming: | 220 |
| LEAP-Seq n nonconfirming: | 275 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCGAGTTGCAGGATAAT |
| Suggested primer 2: | CATCACCTTCACTCCCCACT |