Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.051379 |
Chromosome: | chromosome 5 |
Location: | 1659020 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g243050 | TRX3,TRXf2,TRXF2 | (1 of 1) PTHR10438:SF258 - THIOREDOXIN F1, CHLOROPLASTIC-RELATED; Thioredoxin f2, chloroplastic | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGCTACCGCCAAGGGCTACCGCCACG |
Internal bar code: | TCGGGCCAGGTGACGCCTCTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 633 |
LEAP-Seq percent confirming: | 96.1749 |
LEAP-Seq n confirming: | 2112 |
LEAP-Seq n nonconfirming: | 84 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGACAAGTGTTCCCCGGTC |
Suggested primer 2: | TTGAGCCACACCCACAATTA |