| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.051512 |
| Chromosome: | chromosome 17 |
| Location: | 7018108 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g746597 | (1 of 2) K16296 - serine carboxypeptidase-like clade I [EC:3.4.16.-] (SCPL-I) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGAGTGCTGCCAGGTTGGCGGACAGCTT |
| Internal bar code: | CTCTTTAGACCGACCAATTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 98.7787 |
| LEAP-Seq n confirming: | 1375 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTAATGCCATGAGACGG |
| Suggested primer 2: | CTGTTGCACGACAGGGAGTA |