| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.051604 |
| Chromosome: | chromosome 12 |
| Location: | 6148134 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g536050 | ALA1 | (1 of 3) K14802 - phospholipid-transporting ATPase [EC:3.6.3.1] (DRS2, ATP8A); Phospholipid-transporting ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACAGCAGCGGGTTGCCTGGTGCATGAA |
| Internal bar code: | GGAACTACGAGTTCACTGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 285 |
| LEAP-Seq percent confirming: | 94.611 |
| LEAP-Seq n confirming: | 2493 |
| LEAP-Seq n nonconfirming: | 142 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGATGAGCTGACGCTGGTC |
| Suggested primer 2: | AACCATGTTTGACAGCACCA |