Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.051686 |
Chromosome: | chromosome 7 |
Location: | 2969497 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g333000 | CEP4 | (1 of 1) 3.4.22.15 - Cathepsin L; Cysteine endopeptidase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCCCGGCCGCTTATGCCTACTAGTGCC |
Internal bar code: | ATTCTGCTCAAAGCAGATGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 615 |
LEAP-Seq percent confirming: | 99.3408 |
LEAP-Seq n confirming: | 2562 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTAAAGGACCAGGTGTGT |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |