| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.051735 |
| Chromosome: | chromosome 6 |
| Location: | 6138266 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g290150 | CGL65,RIMP1,RIMP | Factor involved in 30S ribosomal subunit maturation; (1 of 1) PF02576 - Putative ribosome maturation factor RimP (DUF150) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCCCTCGCCCGCCATAACCGCGCGCCC |
| Internal bar code: | CCATGGTTCTTCCATGTGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 158 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTACAAGGCTGAGGGCTG |
| Suggested primer 2: | GGGTGTATCCGTGAGCAAGT |