Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.051753 |
Chromosome: | chromosome 2 |
Location: | 6838937 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g119350 | TMG2 | (1 of 2) K15445 - tRNA (guanine9-N1)-methyltransferase [EC:2.1.1.221] (TRMT10A, TRM10, RG9MTD2); tRNA (guanine-N1)-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAACGCCCCCGCTTTCCTTGTGGACGC |
Internal bar code: | AGGACCGTTCGCGTTCATCGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1048 |
LEAP-Seq percent confirming: | 98.4962 |
LEAP-Seq n confirming: | 262 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTTCTTCGTGACGCCCTT |
Suggested primer 2: | AACCTAGGCCCACCTCTTGT |