| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.051790 |
| Chromosome: | chromosome 14 |
| Location: | 1226213 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616250 | PCD4,CPL9 | Conserved in the Plant Lineage; (1 of 1) PTHR33824//PTHR33824:SF3 - FAMILY NOT NAMED // POLYKETIDE CYCLASE / DEHYDRASE AND LIPID TRANSPORT PROTEIN-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAGCCCCGGCCCGCCACCCACAGCCTT |
| Internal bar code: | TTCTACCCGGCACCCTAATCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 121 |
| LEAP-Seq percent confirming: | 88.2952 |
| LEAP-Seq n confirming: | 1388 |
| LEAP-Seq n nonconfirming: | 184 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCAGGAGTTGGTTTCCAC |
| Suggested primer 2: | GTGTTGGTGTGCATTTCCTG |