| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.051803 |
| Chromosome: | chromosome 1 |
| Location: | 466372 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g002700 | (1 of 1) PTHR13083//PTHR13083:SF3 - UNCHARACTERIZED // WD REPEAT-CONTAINING PROTEIN 91 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGATACCAGCCCAAACTAAACCGAACTG |
| Internal bar code: | CGGTGATACCGAGGGAAGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 580 |
| LEAP-Seq percent confirming: | 68.0198 |
| LEAP-Seq n confirming: | 1374 |
| LEAP-Seq n nonconfirming: | 646 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCACCCCCTATTTTCTTA |
| Suggested primer 2: | GTTTACAGTTCCCCCGTCCT |