| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.051804 |
| Chromosome: | chromosome 17 |
| Location: | 2764596 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718500 | MMP2,MMP1,GLE1 | (1 of 2) IPR008752//IPR016517 - Peptidase M11, gametolysin // Peptidase M11, autolysin; Matrix metalloproteinase, gamete lytic enzyme (G-lysin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAATGAGGATCCCGACTGCCAGTAAAGCC |
| Internal bar code: | CTCGATGGAGGGTGTCGACGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 823 |
| LEAP-Seq percent confirming: | 99.5419 |
| LEAP-Seq n confirming: | 9126 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAAGGCTTACCAGAAGGGG |
| Suggested primer 2: | CTGCCTTACCACTGTCCCAT |