| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.051839 |
| Chromosome: | chromosome 12 |
| Location: | 5232025 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528200 | (1 of 1) K10742 - DNA replication ATP-dependent helicase Dna2 (DNA2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCAGCTGCTCCTCCTCCGCATCAAACGC |
| Internal bar code: | TTCACAGTTGCGATGCATGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 73.6258 |
| LEAP-Seq n confirming: | 1326 |
| LEAP-Seq n nonconfirming: | 475 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTGACTAGCGCATTGGA |
| Suggested primer 2: | CCAAGCTGGACATTGAGGAT |