| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.051877 |
| Chromosome: | chromosome 6 |
| Location: | 1711175 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g261450 | High mobility group protein; (1 of 1) K10802 - high mobility group protein B1 (HMGB1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGACGATGATGGTGATGACGATGAGTAA |
| Internal bar code: | AGGCGGCACCACATCTGTAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 786 |
| LEAP-Seq percent confirming: | 99.0448 |
| LEAP-Seq n confirming: | 1659 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATGTTGCACTGGGTTTG |
| Suggested primer 2: | CACATGGTGGTCTGTCAAGG |