| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.051884 |
| Chromosome: | chromosome 12 |
| Location: | 3160913 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g499400 | CYN2,CYN18-2,CYN18B | (1 of 1) K12733 - peptidyl-prolyl cis-trans isomerase-like 1 (PPIL1); Cyclophilin 18-2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGTGCCAGGTCCCCACGCCTGCAAACTC |
| Internal bar code: | GTGCTCCAGGTTTAAAGAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 629 |
| LEAP-Seq percent confirming: | 99.6803 |
| LEAP-Seq n confirming: | 1247 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGACAGTGCTCACACATCT |
| Suggested primer 2: | GTTCCATCTGCAAGTCAGCA |