Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.051942 |
Chromosome: | chromosome 2 |
Location: | 7866468 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g141700 | FAP315 | (1 of 2) PTHR12932//PTHR12932:SF9 - P25 ALPHA-RELATED // TPPP FAMILY PROTEIN CG45057; EF-Hand Containing Flagellar Associated Protein 315 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCACCTCGGCGCCTGATCAGGCCAGGG |
Internal bar code: | CATCACGGGTCAGGCATCGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 36 |
LEAP-Seq percent confirming: | 37.037 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGGTAGGCAGGTAGGGGC |
Suggested primer 2: | ACACACACACACACACACGC |