Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.052186 |
Chromosome: | chromosome 3 |
Location: | 3605206 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g168500 | (1 of 1) PF15370 - Domain of unknown function (DUF4598) (DUF4598) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACTGCAATCGAAGCCATGCAGAGCTGC |
Internal bar code: | GGTGCCCGCGTGACAAGACACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 819 |
LEAP-Seq percent confirming: | 97.1269 |
LEAP-Seq n confirming: | 6592 |
LEAP-Seq n nonconfirming: | 195 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACTGGGACCTCTGTGCTT |
Suggested primer 2: | CTTGTTCATGCCTACGGGTT |