Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.052207 |
Chromosome: | chromosome 16 |
Location: | 6065470 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676200 | (1 of 3) PTHR10751:SF2 - GUANYLATE-BINDING PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCATGTTTTCCACCCCTCGGCTCGGCA |
Internal bar code: | TCGTTCCACGGTTGCTCTGTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 175 |
LEAP-Seq percent confirming: | 99.7359 |
LEAP-Seq n confirming: | 1888 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAAGGTCCCTCAGGGGAAG |
Suggested primer 2: | CGTGGCTGGTGGATTACTTT |