| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.052248 |
| Chromosome: | chromosome 13 |
| Location: | 645796 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566000 | FTL1 | Putative monofunctional formate-tetrahydrofolate ligase; (1 of 1) 6.3.4.3 - Formate--tetrahydrofolate ligase / Tetrahydrofolic formylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGAGGAGCTTCCCCCACCACCCCATTC |
| Internal bar code: | CCTTCTTTAACCCAGGGCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 692 |
| LEAP-Seq percent confirming: | 98.8618 |
| LEAP-Seq n confirming: | 6862 |
| LEAP-Seq n nonconfirming: | 79 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTTCCACCCCCAAGACTG |
| Suggested primer 2: | CGAGGTGAAAGGAGGTGAAG |