Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.052260 |
Chromosome: | chromosome 3 |
Location: | 5298499 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g183700 | BGS1,GSL3,GTR10 | Glucan synthase-like 3; (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAACGACTTCGGCGGGGGCGGCCCCCTGC |
Internal bar code: | GGACAGTCCGATGAGGGATCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 744 |
LEAP-Seq percent confirming: | 56.6911 |
LEAP-Seq n confirming: | 1470 |
LEAP-Seq n nonconfirming: | 1123 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGCCTATCCAACCCACAG |
Suggested primer 2: | GATGAGTGTGCCGCAGAGTA |