| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.052264 |
| Chromosome: | chromosome 14 |
| Location: | 525398 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611484 | (1 of 4) IPR023485 - Phosphotyrosine protein phosphatase I superfamily | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGATGTTGAGAGGTGTCATGTGCCTTG |
| Internal bar code: | TTGGCGAAACGGGCCTCCTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1187 |
| LEAP-Seq percent confirming: | 99.6975 |
| LEAP-Seq n confirming: | 9558 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGATGTAGCGTCTGGTG |
| Suggested primer 2: | ATTGATTGGATCTGCAAGGG |