| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.052298 |
| Chromosome: | chromosome 7 |
| Location: | 3684657 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337516 | CGL75,SMM27 | (1 of 1) PTHR18895//PTHR18895:SF74 - METHYLTRANSFERASE // HEMK METHYLTRANSFERASE FAMILY MEMBER 1; Conserved in the green lineage 75 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCGGCGGCATCCCTGTGTGGCCCAAC |
| Internal bar code: | GCGGGGCCCGAGATCCGCTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 781 |
| LEAP-Seq percent confirming: | 99.3118 |
| LEAP-Seq n confirming: | 7937 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGATGCAGGTGTTGATGG |
| Suggested primer 2: | TCGGTGACTCTGCTCATTTG |