Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.052314 |
Chromosome: | chromosome 7 |
Location: | 3326091 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g334750 | PPP30 | (1 of 3) PTHR12320//PTHR12320:SF15 - PROTEIN PHOSPHATASE 2C // SUBFAMILY NOT NAMED; Phosphoprotein phosphatase 2C-related | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGTCTCTCCCCCCGGTCACCAGTGCCCA |
Internal bar code: | GAACGTCTTAGGGGGAAGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 704 |
LEAP-Seq percent confirming: | 99.7359 |
LEAP-Seq n confirming: | 9441 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCAGAGGCTGTTGGGAGT |
Suggested primer 2: | GGTCTTGTCGTGGGTCTTGT |