| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.052331 |
| Chromosome: | chromosome 12 |
| Location: | 7950630 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g552300 | CTL3 | (1 of 1) IPR001304//IPR016187//IPR024616 - C-type lectin // C-type lectin fold // Pherophorin; Putative pherophorin with C-type lectin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCCAGTCATGCCCGCTACTACTCATAC |
| Internal bar code: | CGTAGAAACACAACCCGGTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1015 |
| LEAP-Seq percent confirming: | 88.4599 |
| LEAP-Seq n confirming: | 2085 |
| LEAP-Seq n nonconfirming: | 272 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTATTCTCGGGTACGGCA |
| Suggested primer 2: | TTTGCCCACTCTATTACCCG |