| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.052331 |
| Chromosome: | chromosome 14 |
| Location: | 266812 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609450 | PWR4 | (1 of 1) IPR000104//IPR006502 - Antifreeze protein, type I // Protein of unknown function PDDEXK-like; PWR motif protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAAGGGGGGGGTGCCCCTTCAAGACAGT |
| Internal bar code: | ATCAGGACCCCCCTATGTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 739 |
| LEAP-Seq percent confirming: | 99.0696 |
| LEAP-Seq n confirming: | 3301 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACCTCTGGTGCAGTTCA |
| Suggested primer 2: | CATTTTAGCGCTTCACGACA |