Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.052345 |
Chromosome: | chromosome 10 |
Location: | 3380622 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g444100 | (1 of 2) PF04564//PF05049 - U-box domain (U-box) // Interferon-inducible GTPase (IIGP) (IIGP) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGTGGGGGTACGGCGGAGCTCGGCG |
Internal bar code: | AGGGAGGTTGGAGAACCCCCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1122 |
LEAP-Seq percent confirming: | 99.1755 |
LEAP-Seq n confirming: | 7578 |
LEAP-Seq n nonconfirming: | 63 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTAAAAGGCGGGTTCCCTA |
Suggested primer 2: | CTGCAGCAACACATGAGGAT |