| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.052380 |
| Chromosome: | chromosome 4 |
| Location: | 3213499 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g226450 | PRP17 | (1 of 1) K12816 - pre-mRNA-processing factor 17 (CDC40, PRP17); Nuclear pre-mRNA splicing factor, component of the spliceosome | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCCCATAGGGGAAAGGGGATACGAGGA |
| Internal bar code: | AGAGACTGGTATTGTGTTCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 99.7476 |
| LEAP-Seq n confirming: | 9484 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACATACCTCGACAGCAGC |
| Suggested primer 2: | AACCACCCCAGTCTTCAGTG |