| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.052504 |
| Chromosome: | chromosome 14 |
| Location: | 4080339 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633789 | (1 of 24) PTHR10641 - MYB-LIKE DNA-BINDING PROTEIN MYB | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCATTACCACAGGAGATTCCGCCGCCG |
| Internal bar code: | CGCATACTGCTGCTTAATCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 86.7924 |
| LEAP-Seq n confirming: | 414 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACCTCCTGAAAACCGTA |
| Suggested primer 2: | TTGTGATGAGACCGCAGAAG |