| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.052571 |
| Chromosome: | chromosome 7 |
| Location: | 464328 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g315550 | (1 of 2) IPR005654//IPR027417 - ATPase, AFG1-like // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCATGCAGGTGCGTGGGCTGGCACATGG |
| Internal bar code: | TTCTCAGTTCTGACTTGAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 336 |
| LEAP-Seq percent confirming: | 51.2914 |
| LEAP-Seq n confirming: | 2105 |
| LEAP-Seq n nonconfirming: | 1999 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACGTGACACTACCACAC |
| Suggested primer 2: | TCGGCAGGGACTAGTAGCAT |