| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.052623 |
| Chromosome: | chromosome 12 |
| Location: | 4442597 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521300 | POB14 | Proteome of basal body 14 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGAAGCGCTCGAGGCCTGGGTCGAGCA |
| Internal bar code: | CGGCACTCTACAAATCCGGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 899 |
| LEAP-Seq percent confirming: | 99.5312 |
| LEAP-Seq n confirming: | 1274 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCGTGACACTGTGTTAGT |
| Suggested primer 2: | TTTCATGTTGGTTGATGCGT |