Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.052662 |
Chromosome: | chromosome 4 |
Location: | 2348934 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g220825 | (1 of 3) PF10601 - LITAF-like zinc ribbon domain (zf-LITAF-like) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACGTTTGCGGCAAAAATGCATACATGCA |
Internal bar code: | AGTAAAGTCATACGGTCTGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 280 |
LEAP-Seq percent confirming: | 1.94175 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 404 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAGTCATGGAGTGAGCGTC |
Suggested primer 2: | CTAAGTAGCCCGAACGCAAG |