| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.052697 |
| Chromosome: | chromosome 9 |
| Location: | 454506 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404450 | MCP24 | Mitochondrial substrate carrier protein; (1 of 1) IPR000104//IPR002067//IPR018108//IPR023395 - Antifreeze protein, type I // Mitochondrial carrier protein // Mitochondrial substrate/solute carrier // Mitochondrial carrier domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACGCAGCGGATGTCGCTACGGCAACGC |
| Internal bar code: | GTCGCATATGGTTCGTTAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 283 |
| LEAP-Seq percent confirming: | 97.1839 |
| LEAP-Seq n confirming: | 1760 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTCCTTCTACCTTGTCG |
| Suggested primer 2: | TCTCAAACATTGCTGGCTTG |