| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.052886 |
| Chromosome: | chromosome 12 |
| Location: | 4122164 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518050 | FAP261 | Flagellar Associated Protein 261; (1 of 2) PTHR16306:SF0 - TRANSLIN-ASSOCIATED FACTOR X-INTERACTING PROTEIN 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCTGGCTGAGCTGCTCCCTCTATTCCT |
| Internal bar code: | ACGGAGTTGCCTATTCGACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 604 |
| LEAP-Seq percent confirming: | 47.0924 |
| LEAP-Seq n confirming: | 1320 |
| LEAP-Seq n nonconfirming: | 1483 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACAGCCTGATGCTCATTC |
| Suggested primer 2: | GTGAGTACCTGAGGCTTCGC |