Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.052892 |
Chromosome: | chromosome 16 |
Location: | 1993445 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g656700 | KIN14A-2,KIN14-5,KIN14A2 | Kinesin motor protein; (1 of 1) PTHR24115//PTHR24115:SF464 - FAMILY NOT NAMED // KINESIN-1-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCATGTGTACTTACGTTGTGGCAACGTA |
Internal bar code: | CTCAACAGATGGGGGAATGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1011 |
LEAP-Seq percent confirming: | 94.8031 |
LEAP-Seq n confirming: | 7607 |
LEAP-Seq n nonconfirming: | 417 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAGGACCTCGCTTACAGCA |
Suggested primer 2: | CCTTCCCTAGCACCACACAT |