Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.052954 |
Chromosome: | chromosome 12 |
Location: | 432692 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g493700 | ZXE2 | Putative zeaxanthin epoxidase; (1 of 4) PF01494//PF13450 - FAD binding domain (FAD_binding_3) // NAD(P)-binding Rossmann-like domain (NAD_binding_8) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTCGTAGATGCGGCCGTACGACACCGCG |
Internal bar code: | GCGGGCGGCCGGATTGTGCGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 56 |
LEAP-Seq percent confirming: | 72.3958 |
LEAP-Seq n confirming: | 139 |
LEAP-Seq n nonconfirming: | 53 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGAGGCGGTAGATGGTGTT |
Suggested primer 2: | TTTGCATGTATGGACGGCTA |