Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.052973 |
Chromosome: | chromosome 4 |
Location: | 374834 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217914 | WDR65,FAP57,BOP2 | (1 of 1) IPR001680//IPR011047//IPR015943//IPR017986 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain; Flagellar Associated Protein 57 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGGCTCGGCGACGGGTTCTTGGTAGTG |
Internal bar code: | AGGCACTACCGGCGCGGCGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 71 |
LEAP-Seq percent confirming: | 1.96711 |
LEAP-Seq n confirming: | 183 |
LEAP-Seq n nonconfirming: | 9120 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGGTGTGCATGAAAGGAC |
Suggested primer 2: | CTAGGTGCCATGCTTCCTTC |