Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.053001 |
Chromosome: | chromosome 6 |
Location: | 8184263 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g305350 | (1 of 1) PTHR11319//PTHR11319:SF32 - G PROTEIN-COUPLED RECEPTOR-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGACCCACGTCGCCGCACTCGCACGCACG |
Internal bar code: | CCGCAAAGCCGAACGGGACGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 787 |
LEAP-Seq percent confirming: | 79.0652 |
LEAP-Seq n confirming: | 1201 |
LEAP-Seq n nonconfirming: | 318 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATGATTGTGGACTGGTTG |
Suggested primer 2: | AGGGCTACATGGGTGAGTTG |