| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.053036 |
| Chromosome: | chromosome 3 |
| Location: | 3757517 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169900 | (1 of 4) IPR023222 - PsbQ-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTGTAAGTACGCAATGCACAGTTATTT |
| Internal bar code: | GGTCTTCGGAATGTAACGCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 845 |
| LEAP-Seq percent confirming: | 99.6264 |
| LEAP-Seq n confirming: | 6666 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGCCTGCTCCTATACGC |
| Suggested primer 2: | AAGAGGTGAGGCGACTGTGT |